View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_high_18 (Length: 268)
Name: NF21623_high_18
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 48600260 - 48600003
Alignment:
| Q |
1 |
tcatgattatgcaacaaggttttaaataaggattttgtgatttcagctgttatagatgccgctttgcatggaatattagtcgtcttggtgtgaattaatc |
100 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600260 |
tcatgattgtgtaacaaggttttaaataaggattttgtgatttcagctgttatagatgcagctttgcatggaatattagtcgtcttggtgtgaattaatc |
48600161 |
T |
|
| Q |
101 |
acggtgttagctatctattgaacttatccaatagaagataagatagcatttcataagttatagcatagttaggtgataatactattgcatatgataatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600160 |
acggtgttagctatctattgaacttatccaatagaagataagatagcatttcataagttatagcatagttaggtgataatactattgcatatgataatcc |
48600061 |
T |
|
| Q |
201 |
ttttcttctcccttgttcatgcattcatactgcaatgccatttttataatattcttcg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
48600060 |
ttttcttctcccttgttcatgcattcatactgcaatgccatttttgtaatatttttcg |
48600003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University