View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_high_20 (Length: 261)
Name: NF21623_high_20
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 32578424 - 32578658
Alignment:
| Q |
10 |
ataatacttaacttcttatgaatctgtctctatgtctctccctaacatggcttggcgttttccattaatggacgtggtctaaagccaatctacactataa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32578424 |
ataatacttaacttcttatgaatctgtctctatgtctctccctaacatggcttggcgttttccattaatagacgtggtctaaagccaatctacactataa |
32578523 |
T |
 |
| Q |
110 |
tagcaggccattaattttgtatgtatcaccccatggtgggagtcctgcaaaactgtcagtatctgttttttaggggtctgattgtgatatgtcagtacct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32578524 |
tagcaggccattaattttgtatgtatcaccccatggtgggagtcctgcaaaactgtcagtatctgttttttaggggtctgattgtgatatgtcagtacct |
32578623 |
T |
 |
| Q |
210 |
acttggcacaatctccctttaatacacaacaacac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32578624 |
acttggcacaatctccctttaatacacaacaacac |
32578658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University