View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_high_22 (Length: 238)
Name: NF21623_high_22
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 21484041 - 21483830
Alignment:
| Q |
14 |
gagatgaattaggtgcatgtgatggtgtaagtgatgaaatgagtatggttttcttggagtggcttaaatcgaacaaagacagtgtctccgcgaatgattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484041 |
gagatgaattaggtgcatgtgatggtgtaagtgatgaaatgagtatggttttcttggagtggcttaaatcgaacaaagacagtgtctccgcgaatgattt |
21483942 |
T |
|
| Q |
114 |
gaggaatgtgaagcttaagaaatcgacgatcgaaagtgctgctaggagattaggtggtggaaaagaagggatgaaacaattgttgaagctcattcttgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483941 |
gaggaatgtgaagcttaagaaatcaacgattgaaagtgctgctaggagattaggtggtggaaaagaagggatgaaacaattgttgaagctcattcttgaa |
21483842 |
T |
|
| Q |
214 |
tgggttcaaact |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21483841 |
tgggttcaaact |
21483830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University