View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_high_9 (Length: 369)
Name: NF21623_high_9
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 33456985 - 33457190
Alignment:
| Q |
1 |
gtttatatttttcaacaatataaataaaagtctcttagaagtgaaaatgagaaaattagtaaaatgaaaccttggttctgagaggatgaagcttaagctg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456985 |
gtttatatttttcaaaaatataaataaaagtctcttagaagtgaaaatgagaaaagtagtaaaatgaaaccttggttctgagaggatgaagcttaagctg |
33457084 |
T |
 |
| Q |
101 |
aaggagatatttgttccaagcatcgttgactttgtcagacatggtgattgatcaaccttggtctgtctccactactgtttttctgttggtgttattaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33457085 |
aaggagatatttgttccaagcatcgttgactttgtcagacatggtgattgatcaaccttggtctgtctccgctactgtttttctgttggtgttattaaca |
33457184 |
T |
 |
| Q |
201 |
attgat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33457185 |
attgat |
33457190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 298 - 348
Target Start/End: Original strand, 33457281 - 33457331
Alignment:
| Q |
298 |
gctcttagatgaggatcatgactcatcatcaccttaaattaatgttaacgt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457281 |
gctcttagatgaggatcatgactcatcatcaccttaaattaatgttaacgt |
33457331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University