View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_low_15 (Length: 302)
Name: NF21623_low_15
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 54910516 - 54910232
Alignment:
| Q |
1 |
tagcattgtagtcattgttttaaatggagctgatttcgagtattaaaattattatggctttcaagtttttgttgtataatattgcttagtctcattattt |
100 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910516 |
tagcattatagtcattgttgtaaatggagctgatttcgagtattaaaattattatggctttcaagtttttgttgtataatattgcttagtctcattattt |
54910417 |
T |
|
| Q |
101 |
acggattcggtactttatagtctacagaaagcatcacaactgacatggatat-ttttgacactaataatagttttgtttctgcttatggattgtttacag |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910416 |
acggattcggtactttatagtctgcagaaagcatcacaactgacatggatattttttgacactaataatagttttgtttctgcttatggattgtttacag |
54910317 |
T |
|
| Q |
200 |
ggaacagaagatgaaattgtggattgttctcatggaaagcggttgtgggagctctcaaaggaaaaatatgaccccttgtgggtta |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910316 |
ggaacagaagatgaaattgtggattgttctcatggaaagcggttgtgggagctctcaaaggaaaaatatgaccccttgtgggtta |
54910232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University