View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_low_24 (Length: 228)
Name: NF21623_low_24
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 8 - 210
Target Start/End: Original strand, 52553726 - 52553924
Alignment:
| Q |
8 |
tcaacaatgcacgcttttttatttatttgaataacgattattttccaccattttaagatgaacatgataactttgtaaataaagttagttagttacaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52553726 |
tcaacaatgcacgcttttttatttatttgaataacgattattttccaccattttaagatgaacatgataactttgtaaataaagtt----agttacaaat |
52553821 |
T |
 |
| Q |
108 |
aaaggataattttgtaacccacttaattttgttaaaattgttttctatattaagatgaaattttaaacacatgcggttgtgctgtttcattggataaatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
52553822 |
aaaggataattttgtaacccacttaattttgttaaaattgttttctacattaagatgaaattttaaacacatgtggttgtactgtttcattggataaatt |
52553921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University