View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21623_low_8 (Length: 385)
Name: NF21623_low_8
Description: NF21623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21623_low_8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 148 - 385
Target Start/End: Complemental strand, 21484600 - 21484366
Alignment:
| Q |
148 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484600 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
21484501 |
T |
|
| Q |
248 |
aatcagatgttgaagtagatcatcaaggttatcatcaaaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484500 |
aatcagatgttgaagtagatcatcaaggtt---atcaaaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
21484404 |
T |
|
| Q |
348 |
ttctatggagatttctcagcaacagcaacaagatcttg |
385 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21484403 |
ttctatggagatttctcaacaacagcaacaagatcttg |
21484366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 14 - 117
Target Start/End: Complemental strand, 21484734 - 21484631
Alignment:
| Q |
14 |
atactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttccacctttacctgattttccatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21484734 |
atactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttcctcctttacctgattttccatg |
21484635 |
T |
|
| Q |
114 |
catg |
117 |
Q |
| |
|
|||| |
|
|
| T |
21484634 |
catg |
21484631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University