View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_high_10 (Length: 405)
Name: NF21624_high_10
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 27807465 - 27807717
Alignment:
| Q |
17 |
aatttggtgactgaattttttaaataatatttttaaagctcaaggttaaattgacaagttagagttttataatagagattaataaagcgtataagatatg |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807465 |
aatttggtgactgaatttttttaataatatttttaaagctcaaggttaaattgacaagttagagttttataatagagattaataaagcgtataagatatg |
27807564 |
T |
|
| Q |
117 |
aattggtgtttctctttattttcttaaaagaggcaagtgatcacatcttgtctttgccttgcccatactttaatatattctactttacaccaacctgaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807565 |
aattggtgtttctctttattttcttaaaagaggcaagtgatcacatcttgtctttgccttgcccatactttaatatattctactttacaccaacctgaag |
27807664 |
T |
|
| Q |
217 |
gtaacccatagttaatgtctttttaacccgttatatcattgatgcaaagaaac |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807665 |
gtaacccatagttaatgtctttttaacccgttatatcattgatgcaaagaaac |
27807717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 306 - 381
Target Start/End: Original strand, 27807754 - 27807829
Alignment:
| Q |
306 |
gagaaatagccaacaacagccactctctttaacctgtctcaccaactcacatctagaagcaattttttgagtcttt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807754 |
gagaaatagccaacaacagccactctctttaacctgtctcaccaactcacatctagaagcaattttttgagtcttt |
27807829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 335 - 368
Target Start/End: Complemental strand, 55169716 - 55169683
Alignment:
| Q |
335 |
taacctgtctcaccaactcacatctagaagcaat |
368 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
55169716 |
taacctgcctcaccaactcacatctagaagcaat |
55169683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University