View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_high_12 (Length: 401)
Name: NF21624_high_12
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 39999138 - 39999530
Alignment:
| Q |
1 |
agtagggcatgcatgctattgaggtctagcgcaaataattggtacacatggtgtatgagtgttgtaaaactcggatagcaaatttgattcttactgataa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39999138 |
agtaggacatgcatgctattgaggtctagcgcaaataattggtacacatggtgtatgagtgttgtaaaactcggatagcaaatttgattcttactgataa |
39999237 |
T |
|
| Q |
101 |
aaaagtttaggacataatttgaaactaacctttcccataaaatttaaatgaagtaatgccattgctatttgactatatggaaatatgatactataaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39999238 |
aaaagtttaggacataatttgaaactaatctttcccataaaatttaaatgaagtaatgccattgctatttgactatatggaaatatgatactataaaagg |
39999337 |
T |
|
| Q |
201 |
atgggatgtccttctagttcagcattcattctcccctttgaatacgaacagattttcactagtgccttgcatggttcttttaagtttcgttgtgacttgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
39999338 |
atgggatgtccttctagttcagcattcattctcccctttgaatacgaacagattttcactagtgccttgcatggtacttttaagtttcgttgtgatttgt |
39999437 |
T |
|
| Q |
301 |
caaggaggcatcctgaggaagaacttctaccagcattcctgccctcgggccaatgacattattatggaaaaaaccctacagcatgtctctgct |
393 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39999438 |
caaggaggcatcctggggaagaacttctaccagcattcctgccctcaggccaatgacattattatggaaaaaaccctacagtatgtctctgct |
39999530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University