View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_high_9 (Length: 418)
Name: NF21624_high_9
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 147 - 400
Target Start/End: Complemental strand, 35951914 - 35951661
Alignment:
| Q |
147 |
ggtcatcatcatcaaataataataagcatgaaattgttcagatgcttgaaactgggcagcaaaatgaaatgcctccattggatgatgatgtggcaatgaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35951914 |
ggtcatcatcatcaaataataataagcatgaaattgttcagatgcttgaaactgggcagcaaaatgaaatgcctccattggatgatgatgtggcaatgaa |
35951815 |
T |
|
| Q |
247 |
gaaacatctcaaggcatgggcttatgcagttgcaatctcaaatgaacctatttctaaggttcacttgatgaactctcaagtttaactccagtccttttgt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35951814 |
gaaacatctcaaggcatgggcttatgcagttgcaatctcaaatgaacctatttctaaggttcacttgatgaactctcaagtttaactccagtccttttgt |
35951715 |
T |
|
| Q |
347 |
caaattaattaatgcatcctaatgctatatatgttgcaccattccataagtact |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35951714 |
caaattaattaatgcatcctaatgctatatatgttacaccattccataagtact |
35951661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 35952048 - 35951991
Alignment:
| Q |
10 |
gtcgaagaatatcgataacaagaccgcggcgtgccaaaaatcttcatcatcagcagtt |
67 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35952048 |
gtcgcagaatatccataacaagaccgcggcgtgccaaaaatcttcatcatcagcagtt |
35951991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University