View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_low_26 (Length: 240)
Name: NF21624_low_26
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 41620488 - 41620283
Alignment:
| Q |
17 |
attcttactagcttcttattgcaactagagagaaactgataatctcattgattgattcaacttcatgcttcttagaacttttgaattctaatacaaagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620488 |
attcttactagcttcttattgcaactagagagaaactgataatctcattgattgattcaacttcatgcttcttagaacttttgaattctaatacaaagta |
41620389 |
T |
|
| Q |
117 |
tgtaactatgtatgacaatggtgaagtagtaaagaaattagcctaaagagaatcaaaatgataagtagaaaatgatgtgaaagatgtactgtttcaatga |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
41620388 |
tgtaactatgtatgacaatggttaagtagtaaaaaaattagcctaaagagaatcaaaatgataagtagaaaatgatgtgaaagaggtactgtttcattga |
41620289 |
T |
|
| Q |
217 |
gaatct |
222 |
Q |
| |
|
|||||| |
|
|
| T |
41620288 |
gaatct |
41620283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University