View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_low_32 (Length: 220)
Name: NF21624_low_32
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 55162069 - 55162258
Alignment:
| Q |
14 |
ccaagaatatatcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaacaattt-----ggtgtctcataggt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55162069 |
ccaacaatatatcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaacaatttaatttggtgtctcataggt |
55162168 |
T |
 |
| Q |
109 |
aaggtatatattaaaagatatatagaagaatctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162169 |
-----atatattaaaagatatatagaagaatctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatc |
55162258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University