View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_low_34 (Length: 214)
Name: NF21624_low_34
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 28590875 - 28590693
Alignment:
| Q |
15 |
atgaatggttatccatattatgggcctatttcttcctttatatttttgtgttgtggtgtcttcactactaccttgcttcctacacatgatagtgggatcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28590875 |
atgaatggttatccatattatgggcctatttcttcctttatatttt-gtgttgtggtgtcttcactactaccttgcttcctacacatgatagtgggatcc |
28590777 |
T |
 |
| Q |
115 |
acgattccccacattcttcttgaagcattgattaagagttaagacaatgatggccaaatttggaggt---attagatgggattagat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28590776 |
g---ttccccacattcttcttgaagcattgattaagagttaagacaatgatggccaaatttggaggtattattagatgggattagat |
28590693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University