View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_low_36 (Length: 202)
Name: NF21624_low_36
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_low_36 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 2 - 202
Target Start/End: Original strand, 12350745 - 12350942
Alignment:
| Q |
2 |
gcctcttcttccgccatcgtcgtgtgtgttgcctgccacttgggctgtgttaagtattgttgattctagatctaannnnnnngggtggtggatgtgcggt |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12350745 |
gcctcttcttccgccatcgtcgtgtgt--tgcctgtcacttgggctgtgttaagtagtgttgattctagatcta-cttttttgggtggtggatgtgcggt |
12350841 |
T |
|
| Q |
102 |
ttaagggtggtggattgtgttcgcactctctgttcaccattttcggttgcctccaccacgccggtggatctgtagttgctttcaaatggcgttgagatta |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350842 |
ttaagagtggtggattgtgttcgcactctctgttcagcattttcggttgcctccaccacgccggtggatctgtagttgctttcaaatggcgttgagatta |
12350941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University