View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21624_low_37 (Length: 201)
Name: NF21624_low_37
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21624_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 47680603 - 47680416
Alignment:
| Q |
1 |
ccttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttactttgtcttcnnnnnnnc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
47680603 |
ccttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttaatttgtcttttttttttc |
47680504 |
T |
|
| Q |
101 |
ttccgaatattttgcgcaattgcgaagaataatccttcaagatttatggaatttaaatggatgataaacttttttaaaagttttgatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680503 |
ttccgaatattttgcgcaattgcgaaaaataatccttcaagatttatgggatttaaatggatgataaacttttttaaaagttttgatg |
47680416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University