View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21624_low_37 (Length: 201)

Name: NF21624_low_37
Description: NF21624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21624_low_37
NF21624_low_37
[»] chr7 (1 HSPs)
chr7 (1-188)||(47680416-47680603)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 47680603 - 47680416
Alignment:
1 ccttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttactttgtcttcnnnnnnnc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||        |    
47680603 ccttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttaatttgtcttttttttttc 47680504  T
101 ttccgaatattttgcgcaattgcgaagaataatccttcaagatttatggaatttaaatggatgataaacttttttaaaagttttgatg 188  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
47680503 ttccgaatattttgcgcaattgcgaaaaataatccttcaagatttatgggatttaaatggatgataaacttttttaaaagttttgatg 47680416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University