View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21626_low_4 (Length: 268)
Name: NF21626_low_4
Description: NF21626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21626_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 55053120 - 55053360
Alignment:
| Q |
8 |
aaacgccaactcaaacgtgaacgtcttcaggcttaataagctatattttacaacttattatgaacaatgtcataactgtttgttttcatgaattccacaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55053120 |
aaacgccaactcaaacgtgaacgtcttcaggtttaataagctatattagacaacttattttgaacaatgtcataagtgtttgttttcatgaattccacaa |
55053219 |
T |
 |
| Q |
108 |
aacatgacgtttcactctgtattcttcaggatnnnnnnnnnnnnnnnnncctttgtccaaacattgccaagtccggtgatgttaattcctgtccttatca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55053220 |
aacatgacgtttcactctgtattcttcaggataaaaaatcaacaaaaaacctttgtccaaaccttgccaagtccggtgatgttaattcctgtccttatca |
55053319 |
T |
 |
| Q |
208 |
agtaaactgtcgtttcagccatgatattcaagcattcaagg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55053320 |
agtaaactgtcgtttcagccatgatattcaagcattcaagg |
55053360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University