View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21626_low_6 (Length: 225)
Name: NF21626_low_6
Description: NF21626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21626_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 1965510 - 1965698
Alignment:
| Q |
20 |
atatgaatgattgattgaatgtggtgaatgattggaaaagaaggnnnnnnnnnn-gtgttggtcattacaaaacagcaattctaccaagagttgttgttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965510 |
atatgaatgattgattgaatgtggtgaatgattggaaaagaaaaaaaaaatgcaagtgttggtcattacaaaacagcaattctaccaagagttgttgttc |
1965609 |
T |
 |
| Q |
119 |
tatctgcatacctgaaatcagctgccgttgtgactcttgggactctttctatccttgactaagttattgcttcatccattttatctgtg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
1965610 |
tatctgcatacctgaaatcagctgccgttgtgactcttgggactctttctatcattgactgagttattgcttcatccattttatctgtg |
1965698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University