View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21627_high_10 (Length: 331)
Name: NF21627_high_10
Description: NF21627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21627_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 37597517 - 37597248
Alignment:
| Q |
1 |
atcctttgatcattcattgtcatccaacaacattttcagtttttgtcactgtatacaacaaaacaaaacctttggtctttggttaatgatttaacctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37597517 |
atcctttgatcattcattgtcatccaacaacattttcagtttttgtcactgtatacaacaaaac-----ctttggtctttggttaatgatttaacctttt |
37597423 |
T |
|
| Q |
101 |
ttgttcaaggcaagcatggtaattttaggtgatttagttcttgaggttaccctgtttgtatgctggataaaaatcaggttcttgtttgtatttgtctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597422 |
ttgttcaaggcaagcatggtaattttagatgatttagttcttgaggttaccctgtttgtatgctggataaaaatcaggttcttgtttgtatttgtctttc |
37597323 |
T |
|
| Q |
201 |
tttagagattgatatcccctagctagggaacataatgtgagctggccggctagaagatgacattactaagtgcatttct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37597322 |
tttagagattgatatcccctagctagggaacataatgtgagct----ggctagaagatgacattactaagtgcatttct |
37597248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 279 - 314
Target Start/End: Complemental strand, 37597212 - 37597177
Alignment:
| Q |
279 |
ttcaacaaaatcatgatgtcatcttaatttcgttat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597212 |
ttcaacaaaatcatgatgtcatcttaatttcgttat |
37597177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University