View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21627_low_13 (Length: 299)
Name: NF21627_low_13
Description: NF21627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21627_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 2 - 282
Target Start/End: Original strand, 50081765 - 50082044
Alignment:
| Q |
2 |
tactatacaacatctaagggtcatggcagatctctcattcatgctagtatgttggaaggatagatgacaagttagaaaatggccaatatcatttcaaaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50081765 |
tactatacaacatctaagggtcatggcagatctctcattcatgctagtatgttggaaggatagatgacaagttagaaaatggccaatatcatttccaaaa |
50081864 |
T |
|
| Q |
102 |
ctgttcgtccagacatgtgatgtccttcaattccatcactgaatttctgatgaaagaattctcatttactacactcatgaatgcaccggcttttttatcg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50081865 |
ctgttcgtccagacatgtgatgtccttcaattccatcactgaatttctgatgaaagaattctcatttacgacactcatgaatgcaccggcttttttatcg |
50081964 |
T |
|
| Q |
202 |
gtcaagggagagaggggttgaaaataaaaagtcacttgcgtaactaactgtacttttttctgatcgatataaatttggcat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50081965 |
gtcaagggagagaggggttgaaaataaaaagtcacttgcgtaactaactgtac-tttttctgatcgatataaatttggcat |
50082044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University