View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21627_low_18 (Length: 238)
Name: NF21627_low_18
Description: NF21627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21627_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 50082261 - 50082052
Alignment:
| Q |
10 |
catcatcaccaatacaaaccaaagaccatccaaataatgttatgtttgtgcctcatctacattaatgccgttttggtgggttagacattattttatcatt |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50082261 |
catcatcaccaatacaaagcaaagaccatccaaataatgttatgtttgtgcctcatctacattaatgccgttttggtgggttagacattattttatcctt |
50082162 |
T |
 |
| Q |
110 |
tttccttttgtggaactagtgatctagctacgataatttaccaattaatataatccaagcatatgattgaacacaagtttacaaattcaagtagctgggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082161 |
tttccttttgtggaactagtgatctagctacgataatttaccaattaatataatccaagcatatgattgaacacaagtttacaaattcaagtagctgggt |
50082062 |
T |
 |
| Q |
210 |
aaacactact |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
50082061 |
aaacactact |
50082052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University