View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21630_low_5 (Length: 287)
Name: NF21630_low_5
Description: NF21630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21630_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 40310172 - 40310446
Alignment:
| Q |
1 |
attccctatggaaatgtggactgttgtaatcagaggtatttgcaaactggtttgtgtgacttgccaaactcatcccactagaattctttcgcggacttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310172 |
attccctatggaaatgtggactgttgtaatcagaggtatttgcaaactggtttgtgtgacttgccaaactcatcccactagaattctttcgcggacttgg |
40310271 |
T |
|
| Q |
101 |
atccagcataccattaacagcaacaacatagtgataatcgacgtcactttgttgattgactcttgattcattagaacttggactctcagattcatttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310272 |
atccagcataccattaacagcaacaacatagtgataatcgacgtcactttgttgattgactcttaattcattagaacttggactctcagattcatttgaa |
40310371 |
T |
|
| Q |
201 |
gttacgagaaaaatcctaagtcgttgagatcctccagctctttcaagctcttcatactcctcaatcatatgatga |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310372 |
gttacgagaaaaatcctaagtcgttgagatcctccagctctttcaagctcttcatactcctcaatcatatgatga |
40310446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University