View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21630_low_7 (Length: 235)
Name: NF21630_low_7
Description: NF21630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21630_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 29525298 - 29525504
Alignment:
| Q |
16 |
attatacttgaagaaaattcagtaaatgttgtagcatcgtaaaggannnnnnnaatccatatatatggacaatggcaataacatcacaggaactcggaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525298 |
attatacttgaagaaaattcagtaaatgttgtagcatcgtaaaggatttgtttaatccatatatatggacaatggcaataacatcacaggaactcggaaa |
29525397 |
T |
|
| Q |
116 |
caatttcaacactgtacacccaacaccgtataaaataacaatttcaatgtgttcggattccgaggaacaaatgaattaatataaaatcagaaaccgtata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29525398 |
caatttcaacactgtacacccaacaccgtatagaataacaatttcaatttgttcggattacgaggaaaaaatgaattaatataaaatcagaaaccgtata |
29525497 |
T |
|
| Q |
216 |
gaatgtg |
222 |
Q |
| |
|
||||||| |
|
|
| T |
29525498 |
gaatgtg |
29525504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University