View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21631_low_3 (Length: 363)
Name: NF21631_low_3
Description: NF21631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21631_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 35250586 - 35250846
Alignment:
| Q |
18 |
aaaacttgcatccttacactttgttcagtggagttagtgacactatatatatgaaacttgagtttgatgcataatcgtcgagttcttctgcatactagta |
117 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35250586 |
aaaacttgtatccttacacttcgttcagtggagttagtgacactatatacatgaaacttgagtttgatgcataattgtcgagttcttctgcatactagtc |
35250685 |
T |
 |
| Q |
118 |
tgtagacttgnnnnnnnnccatttatccctaattggacagtcatagtctttgcctaaccttctatcaacaaaggataacttgccaagtgttcttttaatt |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35250686 |
tgtagacttgaaaaaaa-ccatttatccctaattggacggtcatagtctttgcctaaccttctatcaattaaggataacttgccaagtgttcttttaata |
35250784 |
T |
 |
| Q |
218 |
attattttttggtacaccttaccaagtattctaatcgtttatctatcaattacgctcgacaa |
279 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35250785 |
tttttttttttatacaccttaccaagtattctaatcgtctatctatcaattacgcttgacaa |
35250846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University