View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21633_low_11 (Length: 288)
Name: NF21633_low_11
Description: NF21633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21633_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 115 - 276
Target Start/End: Original strand, 40310285 - 40310446
Alignment:
| Q |
115 |
ttaacagcaacaacatagtgataatcgacgtcactttgttgattgactcttgattcattagaacttggactctcagattcatttgaagttacgagaaaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310285 |
ttaacagcaacaacatagtgataatcgacgtcactttgttgattgactcttaattcattagaacttggactctcagattcatttgaagttacgagaaaaa |
40310384 |
T |
 |
| Q |
215 |
tcctaagtcgttgagatcctccagctctttcaagctcttcatactcctcaatcatatgatga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310385 |
tcctaagtcgttgagatcctccagctctttcaagctcttcatactcctcaatcatatgatga |
40310446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 40310196 - 40310074
Alignment:
| Q |
1 |
aacagtccacatttccatagggaatcatccacatcttcatttgattcagaagcaaaggattgcaacccaacctcttcaaagttgacaagcataacgtcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40310196 |
aacagtccacatttccatagggaatcatccacatcttcatttgattcagaagcaaaggattgcaacccaacctcttcaaagttgacaagcataatgtcaa |
40310097 |
T |
 |
| Q |
101 |
aacgaggtccatatttaacagca |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40310096 |
aacgaggtccatatttaacagca |
40310074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University