View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21633_low_12 (Length: 288)
Name: NF21633_low_12
Description: NF21633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21633_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 232
Target Start/End: Original strand, 15171497 - 15171719
Alignment:
| Q |
10 |
gcagagagaatatgaagaatttaaagtaaaaattaatgctttggtggcaaaggctttgaagaaacctgaggagggttgggttatgcaagatggaactcca |
109 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15171497 |
gcagagagaatatgaagaatttaaagtgaaaattaacgctttggtggcaaaggctctgaagaaacctgaggagggctgggttatgcaagatggaactcca |
15171596 |
T |
 |
| Q |
110 |
tggcctggtaacaacacccgtgatcatccagggatgattcaggtttggatatttcatcctctaacttgttcttgttttatgtacttttcattaagcttat |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15171597 |
tggcctggtaacaacactcgtgatcatccagggatgattcaggtttggatatttcatcctctaacttgttcttgttttatgtacttttcattatgcttaa |
15171696 |
T |
 |
| Q |
210 |
gaaaataacttgtgatatgctta |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15171697 |
gaaaataacttgtgatatgctta |
15171719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 153
Target Start/End: Complemental strand, 5128447 - 5128305
Alignment:
| Q |
11 |
cagagagaatatgaagaatttaaagtaaaaattaatgctttggtggcaaaggctttgaagaaacctgaggagggttgggttatgcaagatggaactccat |
110 |
Q |
| |
|
||||||||||||||||| | |||||| | | ||||||||||||| || |||||| ||| | ||| || || || ||| ||||||||||||||| | | |
|
|
| T |
5128447 |
cagagagaatatgaagagtataaagtcagagttaatgctttggttgctaaggctcagaaaacaccagatgaagggtggactatgcaagatggaacctctt |
5128348 |
T |
 |
| Q |
111 |
ggcctggtaacaacacccgtgatcatccagggatgattcaggt |
153 |
Q |
| |
|
|||| || || || | |||||||| ||||| ||||||||||| |
|
|
| T |
5128347 |
ggccaggaaataattcacgtgatcacccaggcatgattcaggt |
5128305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 156
Target Start/End: Original strand, 30257483 - 30257629
Alignment:
| Q |
10 |
gcagagagaatatgaagaatttaaagtaaaaattaatgctttggtggcaaaggctttgaagaaacctgaggagggttgggttatgcaagatggaactcca |
109 |
Q |
| |
|
|||||| || ||||||||||| || || | |||||||| |||| |||||| || ||| ||||| || ||||| |||||| |||||||||| |||||| |
|
|
| T |
30257483 |
gcagagggagtatgaagaattcaaggtgagaattaatgtactggttgcaaagtctcagaaaaaaccagaagaggggtgggttctgcaagatggtactcca |
30257582 |
T |
 |
| Q |
110 |
tggcctggtaacaacacccgtgatcatccagggatgattcaggtttg |
156 |
Q |
| |
|
|||||||| ||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
30257583 |
tggcctgggaacaacagcgaagatcatccaggaatgattcaggtttg |
30257629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University