View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21634_high_16 (Length: 215)

Name: NF21634_high_16
Description: NF21634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21634_high_16
NF21634_high_16
[»] chr2 (3 HSPs)
chr2 (10-215)||(44575353-44575558)
chr2 (33-169)||(32785575-32785711)
chr2 (36-109)||(1037524-1037597)
[»] chr4 (2 HSPs)
chr4 (55-109)||(12121317-12121371)
chr4 (36-109)||(55908588-55908661)
[»] chr8 (1 HSPs)
chr8 (71-121)||(18315121-18315171)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 44575558 - 44575353
Alignment:
10 catcatcaactcttgtttttgacaaattcacaaatatcttctatggatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaag 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44575558 catcatcaactcttgtttttgacaaattcacaaatatcttctatggatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaag 44575459  T
110 agaacattttgaagtgttgagttcttaaccaataattgccagagaaatggagatactttatttttaagttaggacatacaacaaaatccatcaaagaaat 209  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44575458 agaacattttgaagtgttgagttcttaaccaataattgccagacaaatggagatactttatttttaagttaggacatacaacaaaatccatcaaagaaat 44575359  T
210 agaatt 215  Q
    ||||||    
44575358 agaatt 44575353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 33 - 169
Target Start/End: Complemental strand, 32785711 - 32785575
Alignment:
33 aaattcacaaatatcttctatggatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaagagaacattttgaagtgttgagtt 132  Q
    ||||| ||||||| |||||   ||||||| ||||||| ||||||||||||||| ||||||||||| |||||| ||||| |||||  ||| |  || |  |    
32785711 aaattgacaaataccttcttcagatatgttatagcaatagctcaaatcaagtagttgcaaattggaaaaaatagaagaaaacatcctgatgctttcatct 32785612  T
133 cttaaccaataattgccagagaaatggagatacttta 169  Q
    |||||||||||||||| ||  ||||||||| ||||||    
32785611 cttaaccaataattgcgagccaaatggagaaacttta 32785575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 1037597 - 1037524
Alignment:
36 ttcacaaatatcttctatggatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaag 109  Q
    |||||||||| |||||   ||||||| || |||  ||||||||||||| |||||||||||||| ||||||||||    
1037597 ttcacaaataccttcttcagatatgttatggcaggagctcaaatcaagaaattgcaaattggggaaaatggaag 1037524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 55 - 109
Target Start/End: Complemental strand, 12121371 - 12121317
Alignment:
55 gatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaag 109  Q
    ||||||| ||||||||| ||||||||||| |||||||||||||| |||| |||||    
12121371 gatatgttatagcaaaaactcaaatcaagcaattgcaaattggggaaaacggaag 12121317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 55908661 - 55908588
Alignment:
36 ttcacaaatatcttctatggatatgtaatagcaaaagctcaaatcaagtaattgcaaattgggaaaaatggaag 109  Q
    |||||||||| |||||   ||||||| || |||  ||||||||||||| |||||||||||||| ||||||||||    
55908661 ttcacaaataccttcttcagatatgttatggcaggagctcaaatcaagaaattgcaaattggggaaaatggaag 55908588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 18315171 - 18315121
Alignment:
71 agctcaaatcaagtaattgcaaattgggaaaaatggaagagaacattttga 121  Q
    ||||||||||||| || ||||||||||| ||||||||||| || |||||||    
18315171 agctcaaatcaagcaactgcaaattggggaaaatggaagaaaatattttga 18315121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University