View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21634_low_11 (Length: 290)
Name: NF21634_low_11
Description: NF21634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21634_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 272
Target Start/End: Complemental strand, 31783604 - 31783345
Alignment:
| Q |
15 |
cataggagaattattctaagaaactttgatgatcctaacatttttatgctacatggtatttgctccattgataataataagataatttagagttcttacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31783604 |
cataggagaattattctaagaaactttgatgatcctaacatttttatgctacaaggtatttgctccattgataataataagataatttagagttcttacg |
31783505 |
T |
 |
| Q |
115 |
tatatatata--caataaaaaataaaagtgacccttgacgagcttcaactagaagcgtcaacgcacaacgtttacttgtggtaaactacaacattgctgc |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31783504 |
tatatatatatacaataaaaaataaaagtgacccttgacgagcttcaactagaagcgtcaacgcacaacgtttacttgtggtaaactacaacattgctgc |
31783405 |
T |
 |
| Q |
213 |
tatatttcccggaaacgaatgcgctaagattcctttcgggatacggcctaaccctggtaa |
272 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31783404 |
tatatttcctggaaacgaatgcgctaagattcctttcgggacacggcctaaccctggtaa |
31783345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University