View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21634_low_13 (Length: 267)
Name: NF21634_low_13
Description: NF21634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21634_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 41823797 - 41823595
Alignment:
| Q |
1 |
gttgtaagaaatcaatcatcactaaaatagaaaagaaaatacaacatggctcgtttcttttctcttgtggtggtgtttcttttatgtgcttcattctcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41823797 |
gttgtaagaaatcaatcatcactaaaatagaaaagaaaatacaacatggctcgtttcttttctcttgtggtggtgtttcttttatgtgcttcattctcct |
41823698 |
T |
 |
| Q |
101 |
gtgttgcttcaaacaaaattgtagatgtggataccttatgtaaagatgcaatggatcctaaattttgctccacattgatcaaatcaaagcctggtgcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41823697 |
gtgttgcttcaaacaaaattgtagatgtggataccatatgtaaagatgcaatggatcctaaattttgctccacattgatcaaatcaaagcctggtgcaga |
41823598 |
T |
 |
| Q |
201 |
aag |
203 |
Q |
| |
|
||| |
|
|
| T |
41823597 |
aag |
41823595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 198 - 258
Target Start/End: Original strand, 41823971 - 41824031
Alignment:
| Q |
198 |
agaaagtaactcgtcaacaaatcctaattcaactgacaaaaatgttaaaattgtgatgatg |
258 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41823971 |
agaaagttactcgtcaacaaatcttaatttaactgacaaaaatgttaaaattgtgatgatg |
41824031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University