View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21635_low_11 (Length: 288)
Name: NF21635_low_11
Description: NF21635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21635_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 45757580 - 45757464
Alignment:
| Q |
19 |
agctcttggaatcctaacctatagtgtgagtttgtggtttctttaaggggcaaaaacataccgtacgttgtgcattttcgtattcttaccaacccgagag |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45757580 |
agctcttggaatcctaacctacagtgtgagtttgtggtttctttaaggggcaaaaaaataccgtacgttgtgcattttcgtattcttaccaactcgagag |
45757481 |
T |
|
| Q |
119 |
tacttcaaatcttaaat |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45757480 |
tacttcaaatcttaaat |
45757464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 210 - 288
Target Start/End: Complemental strand, 45757388 - 45757310
Alignment:
| Q |
210 |
accaaaggaagcctttggaaacattcgtaagttacaaggaaattgagtttgggaatcaatcactttccacgaaataaaa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45757388 |
accaaaggaagcctttggaaacattcgtaagttacaaggaaattgagtttgggaatcaatcactttccacgaaataaaa |
45757310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University