View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21636_high_16 (Length: 427)
Name: NF21636_high_16
Description: NF21636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21636_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 99 - 313
Target Start/End: Original strand, 3724787 - 3725001
Alignment:
| Q |
99 |
ctcctatttccgatactttcactcagaacagaaaattggagtttgatattatttcaggaacatcaatgtcgtgtttgaatgcgtatggtgcaagaacgta |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3724787 |
ctcctatttccgatactttcactgagaacagaaaattggagtttgatattatttcaggaacatcaatgtcgtgtttgaatgcgtatggtgcaacaacgta |
3724886 |
T |
|
| Q |
199 |
cataaataatttcatcccacttggtccattgttgctatccgttcagctataatgggggtataatgacaacagataatagaaatgagtagtgccaggcctc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3724887 |
cataaataatttcatcccacttggtccattgttgctatccgttcagctataatgggggtataatgacaacagataatagaaatgagtagtgccacgcctc |
3724986 |
T |
|
| Q |
299 |
aaagatcctgtagaa |
313 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3724987 |
aaagatcctgtagaa |
3725001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 3724666 - 3724714
Alignment:
| Q |
18 |
ataaacgaattaaatacatctctatcatttcaacaatattgttagctaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3724666 |
ataaacgaattaaatacatctctatcatttcaacaatattgttagctaa |
3724714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 347 - 412
Target Start/End: Original strand, 3725008 - 3725075
Alignment:
| Q |
347 |
ataaaagaaataaaagtataatcaaagatcctgtagaacatat--aagctaacatactcttttcactc |
412 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3725008 |
ataaaagaaatagaagtataatcaaagatcatgtagaacatataaaagctaacatactcttttcactc |
3725075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 3723349 - 3723394
Alignment:
| Q |
130 |
aaaattggagtttgatattatttcaggaacatcaatgtcgtgtttg |
175 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
3723349 |
aaaattggagtttaatattatttcagaaacatcaatgtcatgtttg |
3723394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University