View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21636_high_40 (Length: 203)

Name: NF21636_high_40
Description: NF21636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21636_high_40
NF21636_high_40
[»] chr7 (1 HSPs)
chr7 (19-188)||(14539110-14539279)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 14539279 - 14539110
Alignment:
19 ggagggtggcacacgtggcggggagcggtagggaccaaagtatgagtggcagtgcaacctttgggaggcagagccaacaagtgacacttgatacgtacga 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
14539279 ggagggtggcacacgtggcggggagcggtagggaccaaagtatgagtggcagtgcaacctttgggaggcagagccagcaagtgacacttgatacgtacga 14539180  T
119 tagggaatttggtatgactggtttcacttcaacttcaatagcttctatggataacaccagctctgagaag 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14539179 tagggaatttggtatgactggtttcacttcaacttcaatagcttctatggataacaccagctctgagaag 14539110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University