View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21636_low_10 (Length: 508)
Name: NF21636_low_10
Description: NF21636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21636_low_10 |
 |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0144 (1 HSPs) |
 |  |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 48 - 370
Target Start/End: Complemental strand, 54005832 - 54005499
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccactcacggcccttcctttcctcacacttttctaac |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
54005832 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccactcacggcccttccttccctcagatttttctaac |
54005733 |
T |
 |
| Q |
148 |
gcacgcaatttcaaacttcaacttccctctt----------atatattgtcgctgcccagtccgctttcaatctaccaataattgttgtcatagtcgagg |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54005732 |
gcacacaatttcaaacttcaacttccctcttcagctcttttatatattgtcgctgcccattccgctttcaatctaccaataattgttgtcatagtcgagg |
54005633 |
T |
 |
| Q |
238 |
tgaaagccctcttcttagtctctctc-cacaccctatcttagttttttcacttcgaatttgaaagttaaatttttgtctctagttgatttttgaatttat |
336 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54005632 |
tgaaagccctcttcttagtctctctctcacaccctatctcagttttttcacttcgaatttaaaagttaaatttttgtctctagttgatttttgaattgat |
54005533 |
T |
 |
| Q |
337 |
aagtggtttgttattgtatgtctatgtctttgtt |
370 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||| |
|
|
| T |
54005532 |
aaatggtttgttgttgtatgtctatgtctttgtt |
54005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 363 - 492
Target Start/End: Original strand, 54006069 - 54006198
Alignment:
| Q |
363 |
tctttgttttggtagtatcttaagcttgggattgctctaacattagtatcaccttaaatttggagtaggaacattaaagaatttggttacactaaataaa |
462 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54006069 |
tctttgttttggtagtgtcttaagcttgggattgctctaacattagtatcaccttaaatttggagtaggaacattaaagaatttggttacactaaataaa |
54006168 |
T |
 |
| Q |
463 |
agagacacacaaattggtctctcttctata |
492 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
54006169 |
agggacacacaaattggtctctcttctata |
54006198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 186 - 370
Target Start/End: Complemental strand, 39478045 - 39477859
Alignment:
| Q |
186 |
gtcgctgcccagtccgctttcaatctacc-aataattgttgtcatagtcgaggtgaaa-gccctcttcttagtctctctc-cacaccctatcttagtttt |
282 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| | ||| ||||| ||||||||| ||||||||| ||||||||||| ||| |||| ||| |||||| |
|
|
| T |
39478045 |
gtcgctgcccgttccgctttcaatctacccaatcaacattgccatagctgaggtgaaaagccctcttcgtagtctctctctcactccctgtctcagtttt |
39477946 |
T |
 |
| Q |
283 |
ttcacttcgaatttgaaagttaaatttttgtctctagttgatttttgaatttataagtggtttgttattgtatgtctatgtctttgtt |
370 |
Q |
| |
|
| ||||| |||||||||||| || || || ||||| ||||||||||||||| ||||||| | |||| |||||||| |||||||||||| |
|
|
| T |
39477945 |
t-cactttgaatttgaaagtcaatttcttatctcttgttgatttttgaattgataagtgttctgttgttgtatgtatatgtctttgtt |
39477859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 277 - 370
Target Start/End: Complemental strand, 47561013 - 47560920
Alignment:
| Q |
277 |
agttttttcacttcgaatttgaaagttaaatttttgtctctagttgatttttgaatttataagtggtttgttattgtatgtctatgtctttgtt |
370 |
Q |
| |
|
||||||| ||||| ||||||||||| ||| || ||||| || ||||||||||||||| ||| ||| |||||| |||||||||||| |||||||| |
|
|
| T |
47561013 |
agtttttccactttgaatttgaaaggtaatttcttgtcacttgttgatttttgaattgataggtgttttgttgttgtatgtctatatctttgtt |
47560920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 50 - 115
Target Start/End: Complemental strand, 47561224 - 47561159
Alignment:
| Q |
50 |
ataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccact |
115 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||||||||||||||| || |||||| |||||| |
|
|
| T |
47561224 |
ataaggaaaatactaaaacactctttgttattaaagaaaaatacaaaacggctcaccctctccact |
47561159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 4758814 - 4758776
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4758814 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
4758776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 53621365 - 53621327
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53621365 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
53621327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2385232 - 2385194
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2385232 |
aaagtcaactttctcttgtaaataggaccggagggagta |
2385194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 6246719 - 6246757
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
6246719 |
aaagtcaactttctcttgtaaataggaccggagggagta |
6246757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 20688527 - 20688565
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
20688527 |
aaagtcaactgtctcttgtaaataggaccggaggtagta |
20688565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 5 - 39
Target Start/End: Original strand, 36099602 - 36099636
Alignment:
| Q |
5 |
tcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
36099602 |
tcaactgtctcttgtaaataggaccggagggagta |
36099636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 38687948 - 38687910
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38687948 |
aaagtcaactttctcttgtaaataagaccggagggagta |
38687910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 49122558 - 49122520
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49122558 |
aaagtcaactgtctcttgtaaatagaaccggagggagta |
49122520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 9e-22; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 222 - 363
Target Start/End: Complemental strand, 21933845 - 21933705
Alignment:
| Q |
222 |
gttgtcatagtcgaggtgaaagccctcttcttagtctctctccacaccctatcttagttttttcacttcgaatttgaaagttaaatttttgtctctagtt |
321 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || |||||||| || || | ||| |||||||||||||||||||||||| | || || |||||||| || |
|
|
| T |
21933845 |
gttgtcatagccgaggtgaaagccctcttcgtaatctctctc-actccttgtctcagttttttcacttcgaatttgaaaatcaatttcttgtctcttgtc |
21933747 |
T |
 |
| Q |
322 |
gatttttgaatttataagtggtttgttattgtatgtctatgt |
363 |
Q |
| |
|
||||||||||| ||| || |||||| |||||||| ||||| |
|
|
| T |
21933746 |
gatttttgaatcgatagatgttttgttgttgtatgtttatgt |
21933705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 273 - 370
Target Start/End: Complemental strand, 8562383 - 8562286
Alignment:
| Q |
273 |
tcttagttttttcacttcgaatttgaaagttaaatttttgtctctagttgatttttgaatttataagtggtttgttattgtatgtctatgtctttgtt |
370 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| || |||| | | ||||||||||||||| ||| ||| |||||| |||||| || ||||||||||| |
|
|
| T |
8562383 |
tcttaggtttttcacttcgaatttgaaagttaatttcttgtttgttgttgatttttgaattgataggtgttttgttgttgtatatccatgtctttgtt |
8562286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 97
Target Start/End: Complemental strand, 8562607 - 8562559
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaa |
97 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
8562607 |
ctattaggaaattacaaaaacaccctt-gctattaaagaaaaatacaaaa |
8562559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 20397926 - 20397964
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
20397926 |
aaagtcaactttctcttgtaaataggaccggagggagta |
20397964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 34281706 - 34281668
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34281706 |
aaagtcaactttctcttgtaaataggaccggagggagta |
34281668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 8562521 - 8562484
Alignment:
| Q |
141 |
ttctaacgcacgcaatttcaaacttcaacttccctctt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8562521 |
ttctaacgcacaaaatttcaaacttcaacttccctctt |
8562484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 48 - 100
Target Start/End: Complemental strand, 21934033 - 21933981
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||| |||| | ||||| |
|
|
| T |
21934033 |
ctataaggaaattactaaaacaccccttgttattcaagaagaatatataatgg |
21933981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 278 - 370
Target Start/End: Original strand, 24773313 - 24773405
Alignment:
| Q |
278 |
gttttttcacttcgaatttgaaagttaaatttttgtctctagttgatttttgaatttataagtggtttgttattgtatgtctatgtctttgtt |
370 |
Q |
| |
|
||||||||||||||||||||||||| || || |||||||| ||||||||||||| | ||| ||| ||| || ||||||||||||||||||||| |
|
|
| T |
24773313 |
gttttttcacttcgaatttgaaagtcaatttcttgtctcttgttgatttttgaactgatacgtgatttattgttgtatgtctatgtctttgtt |
24773405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 48 - 115
Target Start/End: Original strand, 24773051 - 24773118
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccact |
115 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
24773051 |
ctataaggaaatcactaaaacaccccttgttattaaaggaaaatacaaaatggttcaccctctccact |
24773118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 6761576 - 6761614
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6761576 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
6761614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 16241304 - 16241266
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16241304 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
16241266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 7765831 - 7765793
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7765831 |
aaagtcaactttctcttgtaaataggaccggagggagta |
7765793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 18452679 - 18452717
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18452679 |
aaagtcaactgtctcttgtaaataggaccgaagggagta |
18452717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 32750379 - 32750341
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
32750379 |
aaagtcaactttctcttgtaaataggaccggagggagta |
32750341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 48 - 302
Target Start/End: Original strand, 2705 - 2975
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaa-tggtccaccctttccact-------cacggcccttcctttcctcacact |
139 |
Q |
| |
|
||||||| |||||| ||||||| | || |||||||||||||||||||| ||||||||| | || ||| |||| |||||||||| | || || |
|
|
| T |
2705 |
ctataagaaaattagtaaaacattcctttttattaaagaaaaatacaaaaatggtccaccttctctactactcaaccacgacccttccttttcccaggct |
2804 |
T |
 |
| Q |
140 |
tttctaacgcacgcaatttcaaacttcaacttccctcttata------tattgtcgctgcccagtccgctttcaatctacc-aataattgttgtcatagt |
232 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||| | || ||| |||||||| ||| ||||||| |||| ||| | ||||||||||| |
|
|
| T |
2805 |
cttctaacgcacacaatttccaacttcaactttcctcttcaactcttttaatgtggctgcccattccactttcaagttacccaatcagtgttgtcatagc |
2904 |
T |
 |
| Q |
233 |
cgaggtgaaagccctcttcttagtctctctc-cacaccctatcttagttttttcacttcgaatttgaaagt |
302 |
Q |
| |
|
||| ||||||||||||||| ||||||||||| || || | |||||||||||||||| ||||||||||||| |
|
|
| T |
2905 |
cgatgtgaaagccctcttcgtagtctctctcttactccttgtcttagttttttcactgcgaatttgaaagt |
2975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 48 - 115
Target Start/End: Complemental strand, 17306411 - 17306345
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccact |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
17306411 |
ctataaggaaaatactaaaacaccctttg-tataaaagaaaaatccaaaatggcccaccctctccact |
17306345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 48 - 115
Target Start/End: Complemental strand, 17273543 - 17273477
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaatggtccaccctttccact |
115 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
17273543 |
ctataaggaaaatactaaaacaccccttg-tataaaagaaaaatccaaaatggcccaccctctccact |
17273477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 25027805 - 25027843
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25027805 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
25027843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 29374281 - 29374319
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29374281 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
29374319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 37699817 - 37699779
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37699817 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
37699779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 904003 - 903965
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
904003 |
aaagtcaactttctcttgtaaataggaccggagggagta |
903965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 1643455 - 1643493
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1643455 |
aaagtcaactgtctcttataaataggaccggagggagta |
1643493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 5 - 39
Target Start/End: Original strand, 13144995 - 13145029
Alignment:
| Q |
5 |
tcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
13144995 |
tcaactgtctcttgtaaataggaccggagggagta |
13145029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 26898302 - 26898340
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
26898302 |
aaagtcaactttctcttgtaaataggaccggagggagta |
26898340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 31802995 - 31802957
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
31802995 |
aaagtcaactttctcttgtaaataggaccggagggagta |
31802957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 185 - 263
Target Start/End: Complemental strand, 15909241 - 15909162
Alignment:
| Q |
185 |
tgtcgctgcccagtccgctttcaatctacc-aataattgttgtcatagtcgaggtgaaagccctcttcttagtctctctc |
263 |
Q |
| |
|
|||||||||||| ||| ||||||| |||| ||| | ||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
15909241 |
tgtcgctgcccattccactttcaagttacccaatcagtgttgtcatagccgatgtgaaagccctcttcgtagtctctctc |
15909162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 885639 - 885601
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
885639 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
885601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 14931364 - 14931402
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14931364 |
aaagtcaattgtctcttgtaaatatgaccggagggagta |
14931402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 48 - 178
Target Start/End: Complemental strand, 15909400 - 15909262
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaaa-tggtccaccctttccact-------cacggcccttcctttcctcacact |
139 |
Q |
| |
|
||||||| |||||| ||||||| | || |||||||||||||||||||| ||||||||| | || ||| |||| |||||||||| | || || |
|
|
| T |
15909400 |
ctataagaaaattagtaaaacattcctttttattaaagaaaaatacaaaaatggtccaccttctctactactcaaccacgacccttccttttcccaagct |
15909301 |
T |
 |
| Q |
140 |
tttctaacgcacgcaatttcaaacttcaacttccctctt |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
15909300 |
cttctaacgcacgcaatttccaacttcaactttcctctt |
15909262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 31971067 - 31971029
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
31971067 |
aaagtcaactttctcttgtaaataagaccggagggagta |
31971029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2229107 - 2229069
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2229107 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
2229069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2339401 - 2339439
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2339401 |
aaagtcaactttctcttgtaaataggaccggagggagta |
2339439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 25848078 - 25848116
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25848078 |
aaagtcaactgtctcttgtaaataggaccggaggtagta |
25848116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 27793308 - 27793346
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
27793308 |
aaagtcaactttctcttgtaaataggaccggagggagta |
27793346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 30923958 - 30923920
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
30923958 |
aaagtcaactgtctcttgtaaataggaccggaggaagta |
30923920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 43135155 - 43135193
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
43135155 |
aaagtcaactgtctcttgtaaataggaccggaggaagta |
43135193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 6086938 - 6086900
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6086938 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
6086900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9440165 - 9440130
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggaggga |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9440165 |
aaagtcaactgtctcttgtaaataggaccggaggga |
9440130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10049779 - 10049817
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10049779 |
aaagtcaattgtctcttgtaaataggaccggagggagta |
10049817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 23825260 - 23825298
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
23825260 |
aaagtcaactttctcttgtaaatatgatcggagggagta |
23825298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 26999132 - 26999170
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26999132 |
aaagtcaaatgtctcttgtaaataggaccggagggagta |
26999170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 40214937 - 40214899
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
40214937 |
aaagtcaactttctcttgtaaataggaccggagggagta |
40214899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 51698151 - 51698113
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
51698151 |
aaagtcaactttctcttgtaaataggaccggagggagta |
51698113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 19202287 - 19202251
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggag |
37 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
19202287 |
aaagtcaactttctcttgtaaataggaccggagggag |
19202251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2352420 - 2352458
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2352420 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
2352458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 38830594 - 38830632
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38830594 |
aaagtcaactgtctcttgtaaataggaccggagggagta |
38830632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2961141 - 2961103
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2961141 |
aaagtcaactttctcttgtaaataggaccggagggagta |
2961103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 9301956 - 9301918
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9301956 |
aaagttaactgtctcttgtaaataggaccggagggagta |
9301918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 2 - 39
Target Start/End: Original strand, 28989384 - 28989421
Alignment:
| Q |
2 |
aagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
28989384 |
aagtcaactttctcttgtaaataagaccggagggagta |
28989421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 48 - 96
Target Start/End: Complemental strand, 15739099 - 15739051
Alignment:
| Q |
48 |
ctataaggaaattactaaaacaccctttgctattaaagaaaaatacaaa |
96 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
15739099 |
ctataaggaaatgactaaaacaccacttattattaaagaaaaatacaaa |
15739051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0144 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0144
Description:
Target: scaffold0144; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 4 - 39
Target Start/End: Original strand, 38939 - 38974
Alignment:
| Q |
4 |
gtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38939 |
gtcaactgtctcttgtaaataggaccggagggagta |
38974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 11141 - 11179
Alignment:
| Q |
1 |
aaagtcaactgtctcttgtaaatatgaccggagggagta |
39 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11141 |
aaagtcaactttctcttgtaaataggaccggagggagta |
11179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University