View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21636_low_27 (Length: 304)
Name: NF21636_low_27
Description: NF21636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21636_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 41757431 - 41757611
Alignment:
| Q |
1 |
cgggccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757431 |
cgggccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagat |
41757530 |
T |
|
| Q |
101 |
gaagatcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtctttgt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41757531 |
gaagatcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttaagaaaaagcaagttctgtctttgt |
41757611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 5 - 181
Target Start/End: Original strand, 41765518 - 41765694
Alignment:
| Q |
5 |
ccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagatgaag |
104 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765518 |
ccatcaccatctaagagatcaattttggctttcttcgctggtgggcttcatggggatattaggaatgttctacttgaacattgggaacacaaagatgaag |
41765617 |
T |
|
| Q |
105 |
atcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtctttgt |
181 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
41765618 |
atattcaagttcacaagtaccttccaaagggtgtgtcttactatgctatgttgagaaaaagcaagttttgtctttgt |
41765694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 177 - 304
Target Start/End: Complemental strand, 41757317 - 41757192
Alignment:
| Q |
177 |
tttgtacaagtttggaactgactttgatgtctctggcccctggaaattaaagagaagcagcnnnnnnnnnnnnnnnnttgtgtaaaccacaatgcaggtc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41757317 |
tttgtacaagtttggaactgactttgatgtctctggcccctggaaattaaagagaagcagcaaaaagtttgaaaaaat--tgtaaaccacaatgcaggtc |
41757220 |
T |
|
| Q |
277 |
gcaacatcacggtttttaacgtctcagt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41757219 |
gcaacatcacggtttttaacgtctcagt |
41757192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 114 - 177
Target Start/End: Complemental strand, 26973235 - 26973172
Alignment:
| Q |
114 |
ttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtct |
177 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
26973235 |
ttcaaaagtatcttccaaagggtgtttcttactatgaaatgctgagaaagagcaagttctgtct |
26973172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University