View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_high_23 (Length: 307)
Name: NF21637_high_23
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 22605487 - 22605212
Alignment:
| Q |
14 |
gagatgaattcggattcgataggggataaatcgggtcggatcctgattggagattgggaggaatcggatgaccatgagaggaggaggatggtggatcggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22605487 |
gagatgaattcggattcgataggggataaatcgggtcggatcctgattggagattgggaggaatcggatgaccatgagaggaggaggatggtggatcggt |
22605388 |
T |
 |
| Q |
114 |
tggcgaggaggatagagtgattatcgatggcggagagaaggttcgggttgtctaccacccaaccgggttttccggctccgacttcacccaattctttgca |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22605387 |
tggcgaggagtatagagtgattatcgatggcggagagaaggttcgggttgtctaccacccaaccgggttttccggctcctacttcacccaattctttgca |
22605288 |
T |
 |
| Q |
214 |
ggctatgcatcctaactccttcttatacgatcgcctcttcattcccatgcttgcttcccgaatcgcaccacccttt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22605287 |
ggctatgcatcctaactccttcttatacgatcgcctcttcattcccatgcttgcttcccgaatcgcaccacccttt |
22605212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University