View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_high_34 (Length: 234)
Name: NF21637_high_34
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 34443039 - 34443237
Alignment:
| Q |
17 |
aatatgggaaaaccaacaccgtctaagtgggatgacgcgcaaaaatggcttgttggtttatcaaaaggtggagacaaaggccaatcaaaaagtaaaccaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
34443039 |
aatatgggaaaaccaacaccgtctaagtgggatgacgcgcaaaaatggcttgttggtttatcaaaaggtggagagaaaggtcaatcaaaaagtaaaccaa |
34443138 |
T |
 |
| Q |
117 |
gaaactcaaatgcagatgatttaagattgatagctcctgtgccacaaaaagaggaagaacacgacgatgatggatgccgcgacttcatgacaacaacta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34443139 |
gaaactcaaatgcagatgatttaagattgatagctcctgtgccacaaaaagaggaagaacacgacgatgatggatgccacgacttcatgacaacaacta |
34443237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University