View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_high_9 (Length: 410)
Name: NF21637_high_9
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 45 - 395
Target Start/End: Complemental strand, 32819420 - 32819071
Alignment:
| Q |
45 |
ggaatttgtgatcaccccatcacgattcagtgctgcccagtggaggctcaacctcttattaaccctggcttatgatggattcagaaaaagcaaaacaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32819420 |
ggaatttgtgatcaccccatcacgattcagtgctgcccagtggaggctcaacctcttattaaccctggcttatgatggattcagaaaaagcaaaacaaaa |
32819321 |
T |
 |
| Q |
145 |
ctggataatgttggtccatgataggcatgatactaagtgcatgtttggtattacgctgagtttgctgaaatcacggtgatctgccatgatttcaataaat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32819320 |
ctggataatgttggtccatgataggcatgatactaagtgcatgtttggtattacgctgagtttgctgaaatcacggtgatccgccatgatttcaataaat |
32819221 |
T |
 |
| Q |
245 |
ccactgtgatatcaaacatacactaagttggatgctctaacccattttcatacccataattggaaggnnnnnnnnntacttgtacccgtattcatactcg |
344 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32819220 |
ccaccgtgatatcaaacatacactaagttgggtgctctagcccattttcatacccataattggaagg-aaaaaaaatacttgtacccctattcatactcg |
32819122 |
T |
 |
| Q |
345 |
tgtcggtagcaacttcaatattattatatgtctgatagctaagttatttgt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32819121 |
tgtcggtagcaacttcaatattattatatgtctgatagctaagttatttgt |
32819071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 180 - 220
Target Start/End: Complemental strand, 11199832 - 11199792
Alignment:
| Q |
180 |
agtgcatgtttggtattacgctgagtttgctgaaatcacgg |
220 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
11199832 |
agtgcatgtttggtatcaagatgagtttgctgaaatcacgg |
11199792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University