View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_low_13 (Length: 380)
Name: NF21637_low_13
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 28498414 - 28498691
Alignment:
| Q |
11 |
caaaggtgagatcagagtcacagacaacacggacactgatgagatgtataatatattaatgtggggtccatttttggagggtttccctatgcaaagtgat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28498414 |
caaaggtgagatcagagtcacagacaacacggacactgatgagatgtataatatattaatgtgggttccatttttggagggtttccctatgcaaagtgat |
28498513 |
T |
 |
| Q |
111 |
aggaccgtccgtgatacctctgtctttgtcaggggtcatggtgtaggacccaaaatattggaccatagtggggaccgttgatacattgcaccatccttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28498514 |
aggaccgtccgtgatacctctgtctttgtcaggggtcatggtgtgggacccaaaatattggaccatagtggggaccgttgatacattgcaccatccttct |
28498613 |
T |
 |
| Q |
211 |
cctaaaaagaacgagtgatcaatacctctgccttaggtcacagtggccttacaggtacaacttcatgagaagtcacaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28498614 |
cctaaaaagaacgagtgatcaatacctctgccttaggtcacagtggccttacaggtacaacttcatgagaagtcacaa |
28498691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University