View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_low_22 (Length: 311)
Name: NF21637_low_22
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 48214135 - 48214417
Alignment:
| Q |
19 |
gtatgttcattcaacctgaatctatgtaatttcattatctcatgttttatactcatatttcaaaaccttgtgtgtttatgcatgtttgatctatctatgt |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48214135 |
gtatgttcattcaacctgaatcattgtaatttcattatctcatgttttatactcatatttcaaaaccttgtgtgtttatgcatgttcgatctatctatgt |
48214234 |
T |
 |
| Q |
119 |
ttacgctttatgggcaaacgcatgtgttctcaccatttaatactaaaaaaggtttgtaatcttatacgtttatgttgattttgtgtttgagatctttata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48214235 |
ttacgctttatgggcaaacgcatgtgttctcaccatttaattctaaaaaaggtttgtaatcttatacgtttatggtgattttgtgtttgagatctttatg |
48214334 |
T |
 |
| Q |
219 |
tgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcctaaccttcgatcagctcggtttgtaacctttg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
48214335 |
tgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcctgatcttcgatcagctcggtttgtaacctttg |
48214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University