View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_low_35 (Length: 227)
Name: NF21637_low_35
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 29 - 178
Target Start/End: Original strand, 16778959 - 16779109
Alignment:
| Q |
29 |
gaagcaaaggcaaatggaatgagaaacatgcagatcaggaaaagacaaaacaaattcaccactattgttggagcgaccacatgttccgcagctaaaccta |
128 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
16778959 |
gaagcaaaggcaaatggaatgagagacatgcagatcaggaaaagacaaaacaaattcaccactattgtggaagcgaccacatgttccgcagctaaaccta |
16779058 |
T |
|
| Q |
129 |
-cccatcatgtgccttgtgtcagatgcaatgttgtgctgtttctgcttcct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16779059 |
ccccatcatgtgccttgtgtcagatgcaatgttgtgctgtttctgcttcct |
16779109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University