View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21637_low_8 (Length: 428)
Name: NF21637_low_8
Description: NF21637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21637_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 16 - 412
Target Start/End: Complemental strand, 27888738 - 27888342
Alignment:
| Q |
16 |
attatgtgggtagaaaagacgttcatgtgagcaaagaaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgagatttcttccttttgaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27888738 |
attatgtgggtagaaaagacgttcatgtgagcaaaggaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgaaatttcttccttttgaaa |
27888639 |
T |
 |
| Q |
116 |
caatccttgtctagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttgggg |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27888638 |
caatccttgcccagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttgggg |
27888539 |
T |
 |
| Q |
216 |
gttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagcaagtagttgagtgttgctctttgttggacaatattcttttgcagg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27888538 |
gttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagtaagtagttgagtgttgctctttgctggacaatattcttttgcagg |
27888439 |
T |
 |
| Q |
316 |
ataatatagcgatcacatggatttggaaacacgatccacatgaaggttatctaataaaatgagtaaatcatttattgactcatgacgagcaacaagt |
412 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27888438 |
ataatatagcgattacatggatttggaaacacgatccacatgaaggttatctaataaaaggagtaaatcatttattgactcatgacgagcaacaagt |
27888342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University