View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2163_high_15 (Length: 249)
Name: NF2163_high_15
Description: NF2163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2163_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 38116836 - 38116599
Alignment:
| Q |
1 |
gagtgttaagcctcacattacctatgaatatggtaaaatattggctatataagatatatgacacgtatatttaacatcttaagattttggatgaagatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
38116836 |
gagtgttaagcctcacattacctatgaatatggtaaaatattggctatataagatatgtgacacgtatacataacgtcttaaggttttggatgaagatgt |
38116737 |
T |
 |
| Q |
101 |
gatttcatcctctcttatcctcttgaaacattgactcgttgttacacccgactttcccgaactcctcaacacttcgagacttttaatgttatgaacaaac |
200 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38116736 |
ggtttcatcctctcttatcgtcttgaaacattgactcgttgttacacccgacttccccgaactcctcaacacttcgagacttttaatgttatgaacaaac |
38116637 |
T |
 |
| Q |
201 |
taaaagaacaatgtcctcgcaatcatattgttagaatt |
238 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38116636 |
taaaagaacaatgtcctaacaatcatattgttagaatt |
38116599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 107
Target Start/End: Complemental strand, 30724584 - 30724555
Alignment:
| Q |
78 |
cttaagattttggatgaagatgtgatttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30724584 |
cttaagattttggatgaagatgtgatttca |
30724555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University