View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2163_high_21 (Length: 222)

Name: NF2163_high_21
Description: NF2163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2163_high_21
NF2163_high_21
[»] chr7 (1 HSPs)
chr7 (58-222)||(38116830-38116994)


Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 58 - 222
Target Start/End: Complemental strand, 38116994 - 38116830
Alignment:
58 attggtccgttgttgctctcgaatttcccacaccccaatcagcgatatcaaagctttcgatcgatttggtgagagaatggaagctgaatcatgtgttcga 157  Q
    |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
38116994 attggtccgttgttgctctcgactttcccacaccccaatcagcggtatcaaagctttcgatcgatttggtgagagaatggaagctggatcatgtgttcga 38116895  T
158 tttggttataggatgtgagaactaacatttaaaggggagattgttgaatttcaagtgtgagtgtt 222  Q
    | ||||||||||| |||||||||||||||||| ||||||||||||| |||||||||| |||||||    
38116894 tctggttataggacgtgagaactaacatttaagggggagattgttggatttcaagtgcgagtgtt 38116830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University