View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2163_high_22 (Length: 218)
Name: NF2163_high_22
Description: NF2163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2163_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 12318257 - 12318420
Alignment:
| Q |
1 |
attctgagcactaaattaatctctactgctagcttttatgtgtaaaactcattaaacaattcccagttgaatttatgcatttctatattttacaaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12318257 |
attctgagcactaaattaatctctactgctagcttttatgtgtaaaactcattaaacaatgcccagttgaatttatgcatttctatattttacaaaattc |
12318356 |
T |
 |
| Q |
101 |
tttatgaagcatggcgggtcattagatgatgattggaagcataatgccaatactagagactctcg |
165 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
12318357 |
tttatgaagcatggc-ggtcattagatgatggttggaagcataatgccaacagtagagactctcg |
12318420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 12318438 - 12318490
Alignment:
| Q |
166 |
cctgcgaaatttaggtatatttccgcaggaatttcgtttcctgtggaatttgc |
218 |
Q |
| |
|
|||||||| | |||||||||||||| ||||||| | ||||||| ||||||||| |
|
|
| T |
12318438 |
cctgcgaattgtaggtatatttccgaaggaattccttttcctgcggaatttgc |
12318490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 34593015 - 34593068
Alignment:
| Q |
1 |
attctgagcactaaattaatctctactgctagcttttatgtgtaaaactcatta |
54 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||| ||| |||||| |
|
|
| T |
34593015 |
attctgagcactaaactaatctctactgctagtttctatgtgtgaaattcatta |
34593068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University