View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2163_high_5 (Length: 326)
Name: NF2163_high_5
Description: NF2163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2163_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 310
Target Start/End: Complemental strand, 3017065 - 3016768
Alignment:
| Q |
13 |
aaggtagatggtggatctttgtgtaatccgagtaacttaggatttggtggtcttattcgtaactctaatggtgagtggcatggagagtttcgtgtctgtt |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3017065 |
aaggtagatggtagatctttgtgtaatccgagtaacttaggatttggtggtcttattcgtaactctaatggtgagtggcatggagagtttcgtgtctgtt |
3016966 |
T |
 |
| Q |
113 |
gtggtacaacaaccaatggtaatgcaaaactttctgtcatagtcttcggtttacaatatgtctattgtctgggacgagagccacatacatcttgcgttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016965 |
gtggtacaacaaccaatggtaatgcaaaactttctgccatagccttcggtttacaatatgtctattgtctgggacgagagccacatacatcttgcgttgg |
3016866 |
T |
 |
| Q |
213 |
attctcagacagttttggatcttatcgttgaaggcacctcaaatatgactctttcattcccttggtgaagcatattaagaggtttcgtgatctggaat |
310 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3016865 |
attctcagacaattttagatcttatcgttgaaggcacctcaaatatgactctttcattcccttggtgaagcatattaagaggtttcatgatctggaat |
3016768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University