View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2163_low_22 (Length: 222)
Name: NF2163_low_22
Description: NF2163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2163_low_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 58 - 222
Target Start/End: Complemental strand, 38116994 - 38116830
Alignment:
| Q |
58 |
attggtccgttgttgctctcgaatttcccacaccccaatcagcgatatcaaagctttcgatcgatttggtgagagaatggaagctgaatcatgtgttcga |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38116994 |
attggtccgttgttgctctcgactttcccacaccccaatcagcggtatcaaagctttcgatcgatttggtgagagaatggaagctggatcatgtgttcga |
38116895 |
T |
 |
| Q |
158 |
tttggttataggatgtgagaactaacatttaaaggggagattgttgaatttcaagtgtgagtgtt |
222 |
Q |
| |
|
| ||||||||||| |||||||||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
38116894 |
tctggttataggacgtgagaactaacatttaagggggagattgttggatttcaagtgcgagtgtt |
38116830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University