View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21640_low_3 (Length: 466)
Name: NF21640_low_3
Description: NF21640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21640_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 17 - 371
Target Start/End: Original strand, 6667821 - 6668175
Alignment:
| Q |
17 |
gcaaccaccgccacttctcttcaacgggaatcctttttgctagatagtgaacaaattctgctttgcaaggaacaaagagcagcataaacgaaccagtaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6667821 |
gcaaccaccgccacttctcttcaacgggaatcctttttgctagatagtgaacaaattctgctttgtaaggaacaaagagcagcataaacgaaccagtaaa |
6667920 |
T |
 |
| Q |
117 |
aaacccaacaaggaaaagagttctatcgtcattccaaagcttcactatgctttcaggtttctctttttacacatttcgtttactctttcacatttcttca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6667921 |
aaacccaacaaggaaaagagttctatcgtcattccaaagcttcactatgctttcaggtttctctttttacacatttcgtttactctttcacgtttcttca |
6668020 |
T |
 |
| Q |
217 |
tttcatatttgaattcctctatttgtgatttaggttaacatattgaaaaacgaaacgaatatgtggtggttgatatttagatcatcacaagggagagaga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
6668021 |
tttcatatttgaattcctctatttgtgatttaggttagcatattgaaaaacgaaacgaatatatggtgattgatatttagatcatcacaggggagagaga |
6668120 |
T |
 |
| Q |
317 |
tccgtagcggatagcggtgtcggtattggaagctactaatctttggtgattgaga |
371 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6668121 |
tccgtagcggagagcggtgtcggtattggaagctactaatctttggtgattgaga |
6668175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University