View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21641_high_6 (Length: 270)
Name: NF21641_high_6
Description: NF21641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21641_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 141 - 251
Target Start/End: Complemental strand, 29314641 - 29314531
Alignment:
| Q |
141 |
ttaaacactctctcgttgatacgaccacgttgtacttttttaaaacgccgtgacttgtttgcctgttctcaaagtttacttctttgctattatcaggacc |
240 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29314641 |
ttaaacactctctcattgatacggccacgttgtacttttttaaaacgccatgacttgtttgcctgttctcaaagtttacttctttgctattatcaggacc |
29314542 |
T |
|
| Q |
241 |
gatatcacacc |
251 |
Q |
| |
|
||||||||||| |
|
|
| T |
29314541 |
gatatcacacc |
29314531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University