View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21641_high_6 (Length: 270)

Name: NF21641_high_6
Description: NF21641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21641_high_6
NF21641_high_6
[»] chr3 (1 HSPs)
chr3 (141-251)||(29314531-29314641)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 141 - 251
Target Start/End: Complemental strand, 29314641 - 29314531
Alignment:
141 ttaaacactctctcgttgatacgaccacgttgtacttttttaaaacgccgtgacttgtttgcctgttctcaaagtttacttctttgctattatcaggacc 240  Q
    |||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
29314641 ttaaacactctctcattgatacggccacgttgtacttttttaaaacgccatgacttgtttgcctgttctcaaagtttacttctttgctattatcaggacc 29314542  T
241 gatatcacacc 251  Q
    |||||||||||    
29314541 gatatcacacc 29314531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University