View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21641_low_5 (Length: 287)
Name: NF21641_low_5
Description: NF21641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21641_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 23036427 - 23036683
Alignment:
| Q |
9 |
gagatgaaccagattaggtgttcatcgggcctcacagtactaacgatgaattactcgttgatttgggtttgtgtattcgaaccattgctttatgaatgga |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23036427 |
gagatgaaccagattaggtgttcatcaggcctgaca---ctaacgatgaattactcgttgatttgggtttgtgaattcgaaccattgctttatgaatgga |
23036523 |
T |
 |
| Q |
109 |
gacatttctatgnnnnnnnntaggtacttctgtcgtaagatttgtagatttagaaatttatatttaaagtaacaaaaaagtgacaggagaaaagaaacag |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || |
|
|
| T |
23036524 |
gacatttctatgaaaaaaa-taggtacttctgtcgtaagatttgtagatttagaaatttatatttaaagtaa--aaaaagtgacaggacaaaagaaatag |
23036620 |
T |
 |
| Q |
209 |
atgaatttgacacaattatgtgagttttctcaatattaaaatgttacacatgaattttattaa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
23036621 |
atgaatttgacacaattatgtgagttttcttaaaattaaaatgtcacacatgaattttattaa |
23036683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University