View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21641_low_7 (Length: 236)
Name: NF21641_low_7
Description: NF21641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21641_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 23076671 - 23076560
Alignment:
| Q |
107 |
atagaaagtcctttgaggaatgactgaatgacttagaccctatctagaccgagaggattcaactagccaatacacaacacttttacccggcgcatggctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23076671 |
atagaaagtcctttgaggaatgactgaaagacttagaccctatctagaccgagaggattcaactagccaatacacaacacttttacccgacgcatggctc |
23076572 |
T |
|
| Q |
207 |
ttatcaatgcct |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23076571 |
ttatcaatgcct |
23076560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 23076905 - 23076819
Alignment:
| Q |
19 |
atttataccatcgtcttcaaattgggaaaagtattaaggaagttacatggtagttgtgttagttaaagcaggacaattttaacttag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23076905 |
atttataccatcgtcttcaaattgggaaaagtattaggcaagttacatggtagttgtgttagttagagcaggacaattttaacttag |
23076819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 182
Target Start/End: Complemental strand, 23076518 - 23076479
Alignment:
| Q |
143 |
accctatctagaccgagaggattcaactagccaatacaca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23076518 |
accctatctagaccgagaggattcaactagccaatacaca |
23076479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University