View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21643_high_15 (Length: 322)
Name: NF21643_high_15
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21643_high_15 |
 | |
|
| [»] scaffold0121 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 136
Target Start/End: Original strand, 49059462 - 49059580
Alignment:
| Q |
18 |
tatttatcatcaagcgataatctactatagaccctgtgatttagttcaaatgtttgttaaagagtgaaccagacaagataatgtaatttgtctttataac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49059462 |
tatttatcatcaagcgataatctactataaaccctgtgatttaattcaaatgtttggtaaagagtgaaccagacatgataatgtaatttgtctttataac |
49059561 |
T |
|
| Q |
118 |
ctatacgattgctttgatg |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49059562 |
ctatacgattgctttgatg |
49059580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 176 - 241
Target Start/End: Original strand, 49059625 - 49059690
Alignment:
| Q |
176 |
gttatgtgatcctttcctccaaattaattattctttcttgcaatatcaataataatttatttttat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49059625 |
gttatgtgatcctttcctccaaattaattattctttcttgcaatatcaataataatttatttttat |
49059690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 285
Target Start/End: Original strand, 33528 - 33556
Alignment:
| Q |
257 |
gcttaaatgtgttttttgtctatctattt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33528 |
gcttaaatgtgttttttgtctatctattt |
33556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University